View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_1D_low_26 (Length: 227)
Name: NF0438_1D_low_26
Description: NF0438_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0438_1D_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 12171428 - 12171224
Alignment:
Q |
13 |
atggacatcataggaaagaatcaccagtgaaaacaagaactcacatttattggagtgccagag--gtaagaaatgctaatttccccaagaaaatgttcct |
110 |
Q |
|
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
T |
12171428 |
atggacatcataggaaataatcaccagtgaaaataagaactcacatttattggagtgccagagaggtaagaaatgctaatttccccaagaaaaagttcct |
12171329 |
T |
 |
Q |
111 |
tgtcctcggtaactacagttccagcacaagcagttgacagaacttcaaccaaggaaccaaccgcgcctccatgcagtgttccataggcattctgcatttc |
210 |
Q |
|
|
||||||| | ||||||||||| ||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
T |
12171328 |
tgtcctcagcaactacagttctagcacaagcagttgacagaacttcaactaaggacccaacagcgcctccatgcagtgttccataggcattctgcaattc |
12171229 |
T |
 |
Q |
211 |
cgaca |
215 |
Q |
|
|
||||| |
|
|
T |
12171228 |
cgaca |
12171224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 12415856 - 12415652
Alignment:
Q |
13 |
atggacatcataggaaagaatcaccagtgaaaacaagaactcacatttattggagtgccagag--gtaagaaatgctaatttccccaagaaaatgttcct |
110 |
Q |
|
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
T |
12415856 |
atggacatcataggaaataatcaccagtgaaaataagaactcacatttattggagtgccagagaggtaagaaatgctaatttccccaagaaaaagttcct |
12415757 |
T |
 |
Q |
111 |
tgtcctcggtaactacagttccagcacaagcagttgacagaacttcaaccaaggaaccaaccgcgcctccatgcagtgttccataggcattctgcatttc |
210 |
Q |
|
|
||||||| | ||||||||||| ||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
T |
12415756 |
tgtcctcagcaactacagttctagcacaagcagttgacagaacttcaactaaggacccaacagcgcctccatgcagtgttccataggcattctgcaattc |
12415657 |
T |
 |
Q |
211 |
cgaca |
215 |
Q |
|
|
||||| |
|
|
T |
12415656 |
cgaca |
12415652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University