View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_1D_low_32 (Length: 212)
Name: NF0438_1D_low_32
Description: NF0438_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0438_1D_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 7 - 204
Target Start/End: Complemental strand, 10567054 - 10566857
Alignment:
Q |
7 |
tcaatgagatggacatcaactcggaggttccatgtatggggactgattatttagagttcatgaagacgattagatctattccagaccgtggtgagtttga |
106 |
Q |
|
|
||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10567054 |
tcaatgagaaggaaaacaactcggaggttccatgtatggggactgattatttagagttcatgaagacgattagatctattccagaccgtggtgagtttga |
10566955 |
T |
 |
Q |
107 |
aagtcaatatagtgctatctctgagttatatagttgttctggaccctcagtaacatcctcttggcaaaaggaccaaagtaaatttgtagtgatgtcca |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10566954 |
aagtcaatatagtgctatctctgagttatatagttgttctggaccctcagtaacatcctcttggcaaaaggaccaaagtaaatttgtagtgatgtcca |
10566857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3 times since January 2019
Visitors: 3252