View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_1D_low_36 (Length: 208)
Name: NF0438_1D_low_36
Description: NF0438_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0438_1D_low_36 |
 |  |
|
[»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 46432934 - 46433141
Alignment:
Q |
1 |
acagaatatgcatcccaggttcattggagtaaatctggaaaagaacaagataatctatgaaagaatcaatgtattggcttcaaagcatgcatgcactcct |
100 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46432934 |
acagaatatgcatcccaggttcactggagtaaatctggaaaagaacaagataatctatgaaagaatcaatgtattggcttcaaagcatgcatgcactcct |
46433033 |
T |
 |
Q |
101 |
tctcaattagcattagcatggcttctgcatcagggaaatggcataatccctatccccggtactgtcttgataatatttagaaagaatacttgtgtgttta |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46433034 |
tctcaattagcattagcatggcttctgcatcagggaaatgacataatccctatccccggtactgtcttgataatatttagaaagaatacttgtgtgttta |
46433133 |
T |
 |
Q |
201 |
tgtgatga |
208 |
Q |
|
|
|||||||| |
|
|
T |
46433134 |
tgtgatga |
46433141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 7 - 165
Target Start/End: Original strand, 46438582 - 46438740
Alignment:
Q |
7 |
tatgcatcccaggttcattggagtaaatctggaaaagaacaagataatctatgaaagaatcaatgtattggcttcaaagcatgcatgcactccttctcaa |
106 |
Q |
|
|
||||||||| ||||||| |||| |||| |||||||||||||| | | |||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
46438582 |
tatgcatccaaggttcacaggagaaaatttggaaaagaacaagcttttttatgaacgaatcaatgacttggcttcaaagcatgcatgcactccttctcaa |
46438681 |
T |
 |
Q |
107 |
ttagcattagcatggcttctgcatcagggaaatggcataatccctatccccggtactgt |
165 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
T |
46438682 |
ttagcattagcttggcttctgcatcagggaaatgacataatccctatccctggtactgt |
46438740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University