View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_1D_low_37 (Length: 204)
Name: NF0438_1D_low_37
Description: NF0438_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0438_1D_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 191
Target Start/End: Original strand, 26322549 - 26322721
Alignment:
Q |
17 |
ggacatcagatacaaagtaaggatctagagggaaggttttatcgttcatataatgagaagccacaccagattatattacctattttatcattgtaataat |
116 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26322549 |
ggacatcagatacaaagtaaggatctagagagaaggttttatcgttcatataatgagaagccacaccagattatattacctattttatcattgtaataat |
26322648 |
T |
 |
Q |
117 |
ttgtgtatatcatcataagttacaacttcaggccaatagatggacaattatatttacctgtatggttgatgtcca |
191 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26322649 |
t--tgtatatcatcataagttacaacttcaggccaatagatggacaattatatttacctgtatggttgatgtcca |
26322721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9 times since January 2019
Visitors: 3252