View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_high_10 (Length: 318)
Name: NF0438_2D_high_10
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0438_2D_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 13 - 127
Target Start/End: Complemental strand, 21075550 - 21075430
Alignment:
Q |
13 |
aacctgtgttgtcgtattgaattcttatgacactcgaa-tggactcggccttctgtcatatgccactattatcttaaatcttctaac-----aaacattc |
106 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
T |
21075550 |
aacctctgttgtcgtattgaattcttatgacactcgaaatggactcggccttctgtcatatgccactattatcttaaatcttcgaacaaattaaacattc |
21075451 |
T |
 |
Q |
107 |
aagagatatataaagtgaacc |
127 |
Q |
|
|
|||||||||||| |||||||| |
|
|
T |
21075450 |
aagagatatatagagtgaacc |
21075430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 300
Target Start/End: Complemental strand, 21075132 - 21075064
Alignment:
Q |
232 |
atgactacactcggttaccttgctatcgatgattcaaagcataattctattacttcgtccaagatccta |
300 |
Q |
|
|
|||||||||| |||||||||| |||| ||||||| ||||||||||||||||||| || | ||||||| |
|
|
T |
21075132 |
atgactacacatggttaccttgttatcaatgattcctagcataattctattacttcatcgatgatccta |
21075064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University