View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_high_21 (Length: 253)
Name: NF0438_2D_high_21
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0438_2D_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 39586569 - 39586800
Alignment:
Q |
1 |
atccttttcaacttcttttcataaccaccaaaatcgaaccacctcaaaatcccaacaaattcaccaggattactcgaaccacccaacgataccatctcct |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39586569 |
atccttttcaacttcttttcataaccaccaaaatcaaaccacctcaaaatcccaacaaattcaccaggattactcgaaccacccaacgataccatctcct |
39586668 |
T |
 |
Q |
101 |
taatcatctccctaaatcccttagcttcttcttcatcactcacatcacaatcctcaccataatatctctttccagatatcattctcattatcgtgttaaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39586669 |
taatcatctccctaaatcccttagcttcttcttcatcactcacatcacaatcctcaccataatatctctttccagatatcattctcattatcgtgttaaa |
39586768 |
T |
 |
Q |
201 |
agtcatctccgaaagctttgttttcaactcca |
232 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
39586769 |
agtcatctccgaaagctttgttttcaactcca |
39586800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 38954439 - 38954399
Alignment:
Q |
148 |
caatcctcaccataatatctctttccagatatcattctcat |
188 |
Q |
|
|
||||| |||||||| |||||||||||||| ||||||||||| |
|
|
T |
38954439 |
caatcatcaccatagtatctctttccagagatcattctcat |
38954399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 214
Target Start/End: Complemental strand, 5884410 - 5884330
Alignment:
Q |
134 |
catcactcacatcacaatcctcaccataatatctctttccagatatcattctcattatcgtgttaaaagtcatctccgaaa |
214 |
Q |
|
|
||||||||||||||||||| | ||||| ||||| || || || | |||||||||||| || ||||| ||||| ||||||| |
|
|
T |
5884410 |
catcactcacatcacaatcatttccatagtatcttttccccgacaccattctcattatagtattaaatgtcatttccgaaa |
5884330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 189 times since January 2019
Visitors: 3272