View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_high_28 (Length: 224)
Name: NF0438_2D_high_28
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438_2D_high_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 207
Target Start/End: Original strand, 8137830 - 8138021
Alignment:
| Q |
16 |
gcaaatagcacaaagatcaacattaatattagttgtgaaatgtaaaatggtttccgattaagcaccatgtatataacaagaagcatttggtgatatatga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8137830 |
gcaaatagcacaaagatcaacattaatattagttgtgaaatgtaaaatggtttccgattaagcaccatgtatataacaagaagcatttggtgatatatga |
8137929 |
T |
 |
| Q |
116 |
tgcgcgcaccgaacttgacttatagggcagttaccaaaaaatatattatttctggatgtggtggaaacaagaatgctcgtacccacacatat |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8137930 |
tgtgcgcaccgaacttgacttatagggcagttactaaaaaatatattatttctggatggggtggaaacaagaatgctcgtacccacacatat |
8138021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University