View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_high_6 (Length: 402)
Name: NF0438_2D_high_6
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438_2D_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 1 - 382
Target Start/End: Complemental strand, 42485030 - 42484649
Alignment:
| Q |
1 |
ccgttattaacaacatcaccaataattgcccgtcgtgcaggaatgggcccgggtattggtccaggcccatttataatagcaatgtagacatctccatcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42485030 |
ccgttattaacaacatcaccaataattgcccgtcgtgcaggaatgggcccgggtattggtccaggcccatttataatagcaatgtagacatctccatcta |
42484931 |
T |
 |
| Q |
101 |
atcttgcgaaggcgagagtagagcttccaattaaaattcccgaaacggattgtgagaacgggccaaatagaagaccatggttggaccaaaatgtgctaac |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484930 |
atctcgcgaaggcgagagtagagcttccaattacaattcctgaaacggattgtgagaacgggccaaatagaagaccatggttggaccaaaatgtgctaac |
42484831 |
T |
 |
| Q |
201 |
atgtgcaccggtgtggagatcgaagagtcggacactaccgtcgacgaagccacaggcgaggtgggtgtcggagagagtgaggcagcggcagatgaggttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484830 |
atgtgcaccggtgtggagatcgaagagtcggacactaccgtcgacgaagccacaggcaaggtgggtgtcggagagagtgaggcagcggcagatgaggttt |
42484731 |
T |
 |
| Q |
301 |
tggtggtgatctcctggatcatattgtgggaccactaaagcatgtctacctgtggtaaagttcctagccgttcgatgccagt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484730 |
tggtggtgatctcctggatcatattgtgggaccactaaagcatgtctacctgtggtaaagttcctagccgttcgatgccagt |
42484649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University