View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_low_22 (Length: 339)
Name: NF0438_2D_low_22
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438_2D_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 12 - 200
Target Start/End: Original strand, 4116701 - 4116889
Alignment:
| Q |
12 |
ctgatatgaataattttggttccaacttatgacagacgcacgatatactcgtgatatgtgtctctcatctcttatggtacactttacaacattgaatctc |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
4116701 |
ctgatttgaataattttggttccaacttatcacagacgcacgatatactcgtgatatgtgcatcttatctcttatggtacactttacaacattgaatttc |
4116800 |
T |
|
| Q |
112 |
aagtgtactaaatattacctttcaatagagctgttgagctctttgtttccatcaactacgtcatttagcatgcatattattattaatta |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4116801 |
aagtgtactaaatatgacctttcaatagagttgttgagctctttgtttccatcaactacgtcatttagcatgcgtattattattaatta |
4116889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 210 - 339
Target Start/End: Original strand, 4119233 - 4119362
Alignment:
| Q |
210 |
gtataatgtttttgggtaatgtttgttcttgtggcaatggagcggggcgaggtggtgatggttcaagagaagacggttgtggtgacattttagtagaagt |
309 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4119233 |
gtataatgtttttgggtaatgtatgttcttgtggcaatggagcggggcgaggtggtgatggttcaagagaagacgtttgtggtgacattttagtagaagt |
4119332 |
T |
|
| Q |
310 |
ctccagtgatgaactttgtggtgacgtttc |
339 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
4119333 |
ctccggtgatgaactttgtggtgacgtttc |
4119362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 310 times since January 2019
Visitors: 3263