View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_low_25 (Length: 310)
Name: NF0438_2D_low_25
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438_2D_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 17 - 296
Target Start/End: Original strand, 9462514 - 9462793
Alignment:
| Q |
17 |
aattaatggcatagttcaaattcaacattcaacactatcatatctacaaaagtctcatcactgatcaaactatgaaacactgacacagacacgacattga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9462514 |
aattaatggcatagttcaaattcaacattcaacactatcatatctacaaaagtctcatcactaatcaaactatgaaacactgacacagacacgacattga |
9462613 |
T |
|
| Q |
117 |
caccattgtaaaaatggaagttaatgaatgtaattacacgtgtgagtgttgtgtcagacaatagatatgtcttcggtgtcaatgttgcatagcttcctta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9462614 |
caccattgtaaaaatggaagttaatgaacgtaattacacgtgtgagtgtcgtgtcagacaatagacatgtcttcggtgtcaatgttgcatagcttcctta |
9462713 |
T |
|
| Q |
217 |
acaagggaaataatctttaactacatatatagcatttaggaagtgcatgatttagtagtagaacttactttcttgatgtc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9462714 |
acaagggaaataatctttaactacatatatagcatttaggaagtgcatgatttagtagtagaacttactttcttgatgtc |
9462793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 86 - 119
Target Start/End: Complemental strand, 10335804 - 10335771
Alignment:
| Q |
86 |
ctatgaaacactgacacagacacgacattgacac |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
10335804 |
ctatgaaacactgacacagacacgacagtgacac |
10335771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 86 - 119
Target Start/End: Complemental strand, 33523486 - 33523453
Alignment:
| Q |
86 |
ctatgaaacactgacacagacacgacattgacac |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
33523486 |
ctataaaacactgacacagacacgacattgacac |
33523453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 83 times since January 2019
Visitors: 3244