View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_low_28 (Length: 304)
Name: NF0438_2D_low_28
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0438_2D_low_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 33 - 285
Target Start/End: Original strand, 33294747 - 33294999
Alignment:
Q |
33 |
gaatacctcccttcattctctcttcctcttacatgccctcccatcctctttctctcaaacttcattaaacccaccttaagcttccaacaattcaatatca |
132 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
33294747 |
gaatacctcccttcattctctcttcctcttacatgccctcccatcctctttctctcaaacttcattaaacccaccttaagcttcaaacaattcaatatca |
33294846 |
T |
 |
Q |
133 |
tggtccttataccctcaatttccttatgcaagcttgaatttaatctttttccatctcttttcctaatctagcctcaccaccaatctcataattattgagg |
232 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
33294847 |
tggtccttataccctcaatttccttatgcaagcttgaatttaatctttttccatctcttttcctaatctagcctcaccaccaatctcataattattgatg |
33294946 |
T |
 |
Q |
233 |
ttttaagccaagttcaagtttcaagaatttatacatgtttggatggtgatagt |
285 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
33294947 |
ttttaagccaagttcaagcttcaagaatttatacatgtttggatggtgatagt |
33294999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University