View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_low_30 (Length: 302)
Name: NF0438_2D_low_30
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438_2D_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 40631568 - 40631851
Alignment:
| Q |
1 |
ccctcttctcatgcgctctattttattctgaaaatatttttgttttaaatacaatccatactccttttatggagatttttgtatagaagattggggagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40631568 |
ccctcttctcatgcgctctattttattctgaaaatatttctgtttgaaatacaatccatactccttttatggagatttttgtatagaagattggggagaa |
40631667 |
T |
|
| Q |
101 |
tgagagaaatgtttgtcaaccctctcacacatccttcgaatgaagaggagggataaaactaaatttgtagcacaagaagaagacggagggcgcaaatttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40631668 |
tgagagaaatgtttgtcaaccctctcacacatcctctgaataaagaggagggataaaactaaatttgtagcacaagaagaagacggagggcgcaaatttg |
40631767 |
T |
|
| Q |
201 |
caaaacggaacatttttctttgaccattcatagctacccttacaaaatgagagcaactattgtttaaaatgctaacggtgaaag |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40631768 |
caaaacggaacatttttctttgaccattcatagctacccctacaaaatgagagcaactattgtttaaaatgctaacgatgaaag |
40631851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 107 times since January 2019
Visitors: 3270