View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_low_33 (Length: 271)
Name: NF0438_2D_low_33
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0438_2D_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 156 - 258
Target Start/End: Complemental strand, 26799240 - 26799138
Alignment:
Q |
156 |
gtgttacaccgacacttataaatagtaattacattgaattatattannnnnnncaaactattaactgtgtcgacgtgtcagtatccgtgttgtgtttgat |
255 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||| ||||||||| |
|
|
T |
26799240 |
gtgttacaccgacacttgtaaatagtaattacattgaattatattattttttttaaactattaactgtgtcgacgtatcagtatctgtgtcgtgtttgat |
26799141 |
T |
 |
Q |
256 |
gtc |
258 |
Q |
|
|
||| |
|
|
T |
26799140 |
gtc |
26799138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 26799340 - 26799392
Alignment:
Q |
1 |
ctgccaactaaccatccaaacacagtactgttgtcagtccattcacatgctaa |
53 |
Q |
|
|
|||||||| ||||||||||| ||||||||||||| || |||||||| ||||| |
|
|
T |
26799340 |
ctgccaaccaaccatccaaaaacagtactgttgttggttcattcacaagctaa |
26799392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 156 - 258
Target Start/End: Complemental strand, 10219769 - 10219667
Alignment:
Q |
156 |
gtgttacaccgacacttataaatagtaattacattgaattatattannnnnnncaaactattaactgtgtcgacgtgtcagtatccgtgttgtgtttgat |
255 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||| ||||||||| |
|
|
T |
10219769 |
gtgttacaccgacacttgtaaatagtaattacattgaattatattattttttttaaactattaactgtgtcgacgtatcagtatctgtgtcgtgtttgat |
10219670 |
T |
 |
Q |
256 |
gtc |
258 |
Q |
|
|
||| |
|
|
T |
10219669 |
gtc |
10219667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 10219869 - 10219921
Alignment:
Q |
1 |
ctgccaactaaccatccaaacacagtactgttgtcagtccattcacatgctaa |
53 |
Q |
|
|
|||||||| ||||||||||| ||||||||||||| || |||||||| ||||| |
|
|
T |
10219869 |
ctgccaaccaaccatccaaaaacagtactgttgttggttcattcacaagctaa |
10219921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University