View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_low_35 (Length: 270)
Name: NF0438_2D_low_35
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438_2D_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 94 - 207
Target Start/End: Original strand, 48966038 - 48966151
Alignment:
| Q |
94 |
ttgtaaggtgatgtaagttcttccgatgaacgagaatactccgtgtgatttagcatcttgtgtatactgtctgaaactgaaatggatcctatccatttgt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48966038 |
ttgtaaggtgatgtaagttcttccgatgaacgagaatactccgtgtgatttagcatcttgtgtatactgtctgaaactgaaatggatcctatccatttgt |
48966137 |
T |
|
| Q |
194 |
tttctcaagtatcc |
207 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
48966138 |
tttctcaagtatcc |
48966151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 118 times since January 2019
Visitors: 3270