View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_low_37 (Length: 262)
Name: NF0438_2D_low_37
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0438_2D_low_37 |
 |  |
|
[»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 7 - 262
Target Start/End: Original strand, 16453179 - 16453431
Alignment:
Q |
7 |
tggtgttatcttcatccattctcacattgacccaacctccacctgctgatgcagaaaaaggcctagcccctcatcaaccaatacttctacctacgagtcc |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |||||| |
|
|
T |
16453179 |
tggtgttatcttcatccattctcacattgacccaacctccacctgctgatgcagaaaaaggcctagcccgtca---accaatacttctacctatgagtcc |
16453275 |
T |
 |
Q |
107 |
tttggaggatgtggtaggagaaacttcaaaaagtgttagagaggatggagaagtttatgatattacaattcaaaatgggattgaaagatgtcatgagaat |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16453276 |
tttggaggatgtggtaggagaaacttcaaaaagtgttagagaggatggagaagtttatgatattacaattcaaaatgggattgaaagatgtcatgagaat |
16453375 |
T |
 |
Q |
207 |
gatgctgtccaactggaatcagtattctcttgcaaacttcgttctgaagagtcccc |
262 |
Q |
|
|
||||||||||||||||||||||||| ||||| | |||||| ||||||||||||||| |
|
|
T |
16453376 |
gatgctgtccaactggaatcagtatcctcttccgaacttcattctgaagagtcccc |
16453431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 80 - 183
Target Start/End: Complemental strand, 16349763 - 16349663
Alignment:
Q |
80 |
tcaaccaatacttctacctacgagtcctttggaggatgtggtaggagaaacttcaaaaagtgttagagaggatggagaagtttatgatattacaattcaa |
179 |
Q |
|
|
|||||||||||||| | || ||| |||||||||||||| ||||||||||||| ||||||| | ||||| |||||||||| ||||||| ||||| |
|
|
T |
16349763 |
tcaaccaatacttccaattaagaggcctttggaggatgtcaaaggagaaacttcaggaagtgttccaaaggat---gaagtttatgctattacagttcaa |
16349667 |
T |
 |
Q |
180 |
aatg |
183 |
Q |
|
|
|||| |
|
|
T |
16349666 |
aatg |
16349663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15 times since January 2019
Visitors: 3242