View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_low_39 (Length: 261)
Name: NF0438_2D_low_39
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438_2D_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 26461322 - 26461081
Alignment:
| Q |
1 |
aagaccctatgggatgctaatatacccattttcattagtgcacagtttcatattttgttgaggttgtgaaagagagtgagaaatggggaattgtcaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26461322 |
aagaccctatgggatgctaatatacccattttcattagtgcacagtttcatattttgttgaggttgtgaaagagagtgagaaatggggaattgtcaaaca |
26461223 |
T |
|
| Q |
101 |
atagatgctgcagcactagtgatccaacaccctagtgggaagattgagagattgtattggtcagtgagtgcaagttatgtcatgagagccaatcctggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26461222 |
atagatgctgcagcactagtgatccaacaccctagtgggaagattgagagattgtattggtcagtgagtgcaagttatgtcatgagagcaaatcctggtt |
26461123 |
T |
|
| Q |
201 |
attatgtgtcactcatcatgccattgcctcaagaacaagaag |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26461122 |
attatgtgtcactcatcatgccattgcctcaagaacaagaag |
26461081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 83 - 230
Target Start/End: Complemental strand, 15407146 - 15406999
Alignment:
| Q |
83 |
atggggaattgtcaaacaatagatgctgcagcactagtgatccaacaccctagtgggaagattgagagattgtattggtcagtgagtgcaagttatgtca |
182 |
Q |
| |
|
||||| ||||||||| | | |||||||||| || ||||||||||| || |||||||||| || |||||||||||| |||| | ||| ||| | || | |
|
|
| T |
15407146 |
atgggaaattgtcaagctgttgatgctgcagttcttgtgatccaacatccatgtgggaagatagatagattgtattggccagtaactgctagtgaagtta |
15407047 |
T |
|
| Q |
183 |
tgagagccaatcctggttattatgtgtcactcatcatgccattgcctc |
230 |
Q |
| |
|
||| | ||||||||||| | ||||| ||| | || |||||||| |||| |
|
|
| T |
15407046 |
tgaaaaccaatcctggtcactatgtttcattgattatgccattacctc |
15406999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 26 times since January 2019
Visitors: 3242