View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0438_2D_low_67 (Length: 215)

Name: NF0438_2D_low_67
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0438_2D_low_67
NF0438_2D_low_67
[»] chr6 (1 HSPs)
chr6 (135-205)||(34563139-34563211)


Alignment Details
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 135 - 205
Target Start/End: Original strand, 34563139 - 34563211
Alignment:
135 taattaagatatatactcgcacgctcacac--acatttaaaatagcacatcaaattcataatttgcatgaaca 205  Q
    ||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||||||    
34563139 taattaagatatatactcgcacgctcacactcacatttaaaatagcacatcaaattcataatttacatgaaca 34563211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 226 times since January 2019
Visitors: 3261