View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_2D_low_70 (Length: 203)
Name: NF0438_2D_low_70
Description: NF0438_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438_2D_low_70 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 16453908 - 16453732
Alignment:
| Q |
19 |
atagtctcctgttgaattctttctagatgcttttcattacttttcagtttgttcacagactcaacagttgattggaattcttggcaagatgtcactgcct |
118 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16453908 |
atagtctcctgctgaattctttctagatgcttttcattactcttcagtttgttcacagactcaacagttgattggaattcttggcaagatgtcactgcct |
16453809 |
T |
|
| Q |
119 |
ttcttttgaactctccaagagcctcttgcacctcaacagtccttctactcaatacatccaatagctgatgaagtcca |
195 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16453808 |
ttcttttgaactctgcaagagcctcttgtacctcaacagtccttctactcaatacatccaatagctgatgaagtcca |
16453732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 61 - 193
Target Start/End: Original strand, 16349122 - 16349254
Alignment:
| Q |
61 |
ttcagtttgttcacagactcaacagttgattggaattcttggcaagatgtcactgcctttcttttgaactctccaagagcctcttgcacctcaacagtcc |
160 |
Q |
| |
|
|||||||| ||||||| |||||||| ||||||||||||| | | |||| | |||||| |||||||||| |||| || ||||||||||||||| |||| |
|
|
| T |
16349122 |
ttcagtttattcacagggtcaacagtggattggaattcttcgaatgatgcaagagccttttttttgaactccccaatagactcttgcacctcaactgtcc |
16349221 |
T |
|
| Q |
161 |
ttctactcaatacatccaatagctgatgaagtc |
193 |
Q |
| |
|
|| ||||||| | |||||| ||||||||||||| |
|
|
| T |
16349222 |
ttatactcaaaagatccaagagctgatgaagtc |
16349254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 131 times since January 2019
Visitors: 3270