View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_low_5 (Length: 311)
Name: NF0438_low_5
Description: NF0438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 50373355 - 50373585
Alignment:
| Q |
1 |
ccaaacgaacagttcagatatataaagtccctatagataccacaaaatataaatgactaatttgagctggagcttggacccactactatatcccaaagct |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50373355 |
ccaaacgaacagttcagagatataaagtccctatagaatccacaaaaaataaatgactaatttgagctggagcttggaaccactactatatcccaaagct |
50373454 |
T |
|
| Q |
101 |
gcttaagcatgtgcatgtgcatgtgcacaggagttagcttcacaatatgtgcgacatattttcacttcccaatctagctccaacaaacctattcccaaca |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50373455 |
gcttaagcat------------gtgcacaggagttagcttcacaatatgtgcgacatattttcacttcccaatctagctccaacaaacctattcccaaca |
50373542 |
T |
|
| Q |
201 |
ccactcact----gtcactggtttacggctacacaggttctgc |
239 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
50373543 |
ccactcactgtcagtcactggtttacggctacacagggtctgc |
50373585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1566 times since January 2019
Visitors: 3232