View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438_low_7 (Length: 201)
Name: NF0438_low_7
Description: NF0438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 11 - 78
Target Start/End: Complemental strand, 1971487 - 1971420
Alignment:
| Q |
11 |
cagagacggttgcagcggagacaaaacgaccaaaattgatgccgccatggatgatggtggtgatacgg |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1971487 |
cagagacggttgcagcggagacaaaacgaccaaaattgatgccgccatggatgatggtggtgatacgg |
1971420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 11 - 115
Target Start/End: Complemental strand, 19962499 - 19962396
Alignment:
| Q |
11 |
cagagacggttgcagcggagacaaaacgaccaaaattgatgccgccatggatgatggtggtgatacggggggaaggggaggaagttgaggaaaggaagat |
110 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||| |||| |||||| |||| ||||||||||| ||| |
|
|
| T |
19962499 |
cagagacggttgcagtagagacaaaacgaccaaagttggtgccgccatggatgatggtggtgatacg-ggggtaggggaagaaggtgaggaaaggatgat |
19962401 |
T |
 |
| Q |
111 |
gaaga |
115 |
Q |
| |
|
||||| |
|
|
| T |
19962400 |
gaaga |
19962396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University