View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0439_high_2 (Length: 202)
Name: NF0439_high_2
Description: NF0439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0439_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 31639388 - 31639287
Alignment:
| Q |
1 |
acgttgaaccggttcaatttggcacatcggaccacaatgtaaagaatgcaatgccggtaatannnnnnnnattgttataagttgaatatatgatgtgctt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31639388 |
acgttgaaccgtttcaatttggcacatcggaccacaatgtaaagaatgcaatgccggtaatattttttttattgttataagttgaatatatgatgtgctt |
31639289 |
T |
 |
| Q |
101 |
gg |
102 |
Q |
| |
|
|| |
|
|
| T |
31639288 |
gg |
31639287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University