View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0439_low_1 (Length: 349)
Name: NF0439_low_1
Description: NF0439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0439_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 86 - 263
Target Start/End: Complemental strand, 41695499 - 41695322
Alignment:
| Q |
86 |
gtggagagcggtttaggagccgctggagactagatctatgcagaacttgagtggtgtgagccaacagttgatgaggagagcggtacatgggttgtcgatg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
41695499 |
gtggagagcggtttaggagccgctggagactagatctatgcagaacttgagtggtgtgagccaacagttgatgaggagagcagtacatgggctgtcgatg |
41695400 |
T |
|
| Q |
186 |
acaagattaggtaaataagtgaaagtaaggtttagtgttccgaagggtgtgttgtgtggtttttggttggtgatgatg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41695399 |
acaagattaggtaaataagtgaaagtaaggtttagtgttccgaggggtgtgttgtgtggtttttggttggtgatgatg |
41695322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1482 times since January 2019
Visitors: 3230