View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0439_low_5 (Length: 202)

Name: NF0439_low_5
Description: NF0439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0439_low_5
NF0439_low_5
[»] chr4 (1 HSPs)
chr4 (1-102)||(31639287-31639388)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 31639388 - 31639287
Alignment:
1 acgttgaaccggttcaatttggcacatcggaccacaatgtaaagaatgcaatgccggtaatannnnnnnnattgttataagttgaatatatgatgtgctt 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||    
31639388 acgttgaaccgtttcaatttggcacatcggaccacaatgtaaagaatgcaatgccggtaatattttttttattgttataagttgaatatatgatgtgctt 31639289  T
101 gg 102  Q
    ||    
31639288 gg 31639287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1498 times since January 2019
Visitors: 3230