View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0439_low_6 (Length: 202)
Name: NF0439_low_6
Description: NF0439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0439_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 121
Target Start/End: Original strand, 31639437 - 31639484
Alignment:
| Q |
74 |
gtcatctgactctgccgagagatgaaggtcttaccggttcaatctctg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31639437 |
gtcatctgactctgccgagagatgaaggtcttaccggttcaatctctg |
31639484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 31639364 - 31639403
Alignment:
| Q |
1 |
gtgccaaattgaaccggttcaacgtggttggttcaatcag |
40 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31639364 |
gtgccaaattgaaacggttcaacgtggttggttcaatcag |
31639403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1894 times since January 2019
Visitors: 3241