View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-10 (Length: 140)
Name: NF0440-3-1-Insertion-10
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-10 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 6e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 6e-69
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 40363225 - 40363364
Alignment:
Q |
1 |
gcatattagtacaatattttaatcatagctaggaaatatgcaagcatctaatacatcactggataatcctctggcgttcaatggatgtagcaaagaaatg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40363225 |
gcatattagtacaatattttaatcatagctaggaaatatgcaagcatctaatacatcactggataatcctctggcgttcaatggatgtagcaaagaaatg |
40363324 |
T |
 |
Q |
101 |
gaaattaactgattcagagtattcactacttagttaaaaa |
140 |
Q |
|
|
|||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
40363325 |
gaaattaactgattaagaatattcactacttagttaaaaa |
40363364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2210 times since January 2019
Visitors: 846