View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-17 (Length: 85)
Name: NF0440-3-1-Insertion-17
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440-3-1-Insertion-17 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 4e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 43699365 - 43699281
Alignment:
Q |
1 |
ctttgtggatactagaggttgggaacagatggagggacaacccaatgataaggttacttatgtggagtttgagaatgttggacct |
85 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43699365 |
ctttgtggatactagaggttgggaacagatggagggacaacccaatgataaggttacttatgtggagtttgagaatgttggacct |
43699281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 85
Target Start/End: Complemental strand, 45514122 - 45514083
Alignment:
Q |
46 |
tgataaggttacttatgtggagtttgagaatgttggacct |
85 |
Q |
|
|
|||||| ||||||||||| ||||||||||||||||||||| |
|
|
T |
45514122 |
tgataaagttacttatgttgagtttgagaatgttggacct |
45514083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University