View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-19 (Length: 105)

Name: NF0440-3-1-Insertion-19
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-19
NF0440-3-1-Insertion-19
[»] chr8 (1 HSPs)
chr8 (1-105)||(40534114-40534218)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 6e-53; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 6e-53
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 40534114 - 40534218
Alignment:
1 gtaatgtagttagctttaaattaccatgagaggtctccaattggtgatatcagttacaccttcaaacatcatggcagcactaattgcagcattgtttacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40534114 gtaatgtagttagctttaaattaccatgagaggtctccaattggtgatatcagttacaccttcaaacatcatggcagcactaattgcagcattgtttacc 40534213  T
101 aaatg 105  Q
    |||||    
40534214 aaatg 40534218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2243 times since January 2019
Visitors: 847