View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-20 (Length: 69)
Name: NF0440-3-1-Insertion-20
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-3-1-Insertion-20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 4e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 53267853 - 53267914
Alignment:
| Q |
8 |
cttccattgaacatattataaatttgatatgatgctcactagacacgtaaacatatttattt |
69 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267853 |
cttccattgaacacattataaatttgatatgatgctcactagacacgtaaacatatttattt |
53267914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2310 times since January 2019
Visitors: 849