View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-21 (Length: 90)
Name: NF0440-3-1-Insertion-21
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-3-1-Insertion-21 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 4e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 4e-44
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 37768421 - 37768510
Alignment:
| Q |
1 |
aaaacatcaattagggatttttagactttatctcaacaactaatgagttttatccaaatataatttataatagaatattatgacgtaatt |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37768421 |
aaaacatcaattagggatttttagactttatctcaacaactaatgagttttatccaaatataatttataatagaatattatgacgtaatt |
37768510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 22393933 - 22393896
Alignment:
| Q |
1 |
aaaacatcaattagggatttttagactttatctcaaca |
38 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
22393933 |
aaaacatcaattaaggatttttagattttatctcaaca |
22393896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 42504346 - 42504298
Alignment:
| Q |
42 |
aatgagttttatccaaatataatttataatagaatattatgacgtaatt |
90 |
Q |
| |
|
|||||||| ||||||||||| ||||| |||||| |||||||||||||| |
|
|
| T |
42504346 |
aatgagttatatccaaatatggtttatgatagaacattatgacgtaatt |
42504298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2327 times since January 2019
Visitors: 850