View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-22 (Length: 79)
Name: NF0440-3-1-Insertion-22
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-3-1-Insertion-22 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 11 - 79
Target Start/End: Original strand, 223676 - 223744
Alignment:
| Q |
11 |
ataaactttaattccttaaacaaaaaatcaactcatatcagcaacaacactctcccataaattcatcaa |
79 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
223676 |
ataaactttaattccttatacaaaaaatcaactcatatcagcaacaacactctcccataaattcatcaa |
223744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 11 - 79
Target Start/End: Complemental strand, 38554942 - 38554874
Alignment:
| Q |
11 |
ataaactttaattccttaaacaaaaaatcaactcatatcagcaacaacactctcccataaattcatcaa |
79 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38554942 |
ataaactttaattccttagacaaaaaatcaactcatatcagcaacaacactctcccataaattcatcaa |
38554874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2283 times since January 2019
Visitors: 848