View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-39 (Length: 150)
Name: NF0440-3-1-Insertion-39
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-3-1-Insertion-39 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 5e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 41485135 - 41485278
Alignment:
| Q |
7 |
ctttgcgtgaatattttcttttcgttgttttgtttaatgttttgtcaagagtagtgattccatacaatgatgatgttttagcattaccttcagagtagtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41485135 |
ctttgcgtgaatattttcttttcgttgttttgtttaatgttttgtcaagagtagtgattccatacaatgatgatgttttagcattaccttcagagtagtt |
41485234 |
T |
|
| Q |
107 |
tatccaaatgtctgttcagagttgttttgttttccaaacaagta |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41485235 |
tatccaaatgtctgttcagagttgttttgttttccaaacaagta |
41485278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2185 times since January 2019
Visitors: 845