View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-42 (Length: 80)
Name: NF0440-3-1-Insertion-42
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-3-1-Insertion-42 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 8e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 8e-36
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 39028078 - 39028157
Alignment:
| Q |
1 |
gtagaaagccaatgcaaacaggaaatttcacagcctcaaagtaacaacaacaatgtcacttcttctaatgatagaattac |
80 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39028078 |
gtagaaagccaatgcaaacaggaaaattcacagcctcaaagtaacaacaacaatgtcacttcttctaatgatagaattac |
39028157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2282 times since January 2019
Visitors: 848