View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-3-1-Insertion-43 (Length: 79)
Name: NF0440-3-1-Insertion-43
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-3-1-Insertion-43 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 6 - 79
Target Start/End: Complemental strand, 43853793 - 43853716
Alignment:
| Q |
6 |
gattttggccctctcataaattccaacatat----cagcctcaaaattggttagaaacttatttaactattgatttag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
43853793 |
gattttggccctctcataaattccaacatatatatcagcctcaaaattggtcagaaacttatttaaatattgatttag |
43853716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2268 times since January 2019
Visitors: 848