View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-6 (Length: 123)

Name: NF0440-3-1-Insertion-6
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-6
NF0440-3-1-Insertion-6
[»] chr3 (3 HSPs)
chr3 (30-123)||(42209671-42209764)
chr3 (36-123)||(42221922-42222009)
chr3 (61-123)||(42191070-42191132)


Alignment Details
Target: chr3 (Bit Score: 74; Significance: 2e-34; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 30 - 123
Target Start/End: Complemental strand, 42209764 - 42209671
Alignment:
30 tgtatgtatagctatctaatattgaggtgacatgtttcagaatatggtctaggtggaaaggcttcaactagtggtgatgtgtacagttttggga 123  Q
    ||||| |||||||||||||||||| ||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||    
42209764 tgtatatatagctatctaatattggggtgacatgtttcagaatatggtttaggaggcaaggcttcaactagtggtgatgtgtacagttttggga 42209671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 64; E-Value: 2e-28
Query Start/End: Original strand, 36 - 123
Target Start/End: Complemental strand, 42222009 - 42221922
Alignment:
36 tatagctatctaatattgaggtgacatgtttcagaatatggtctaggtggaaaggcttcaactagtggtgatgtgtacagttttggga 123  Q
    ||||||||||||||| || |||  ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||    
42222009 tatagctatctaatactggggtaccatgtttcagaatatggtctaggaggcaaggcttcaactagtggtgatgtgtacagttttggga 42221922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 63; E-Value: 8e-28
Query Start/End: Original strand, 61 - 123
Target Start/End: Complemental strand, 42191132 - 42191070
Alignment:
61 atgtttcagaatatggtctaggtggaaaggcttcaactagtggtgatgtgtacagttttggga 123  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42191132 atgtttcagaatatggtctaggtggaaaggcttcaactagtggtgatgtgtacagttttggga 42191070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2235 times since January 2019
Visitors: 847