View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-8 (Length: 85)

Name: NF0440-3-1-Insertion-8
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-8
NF0440-3-1-Insertion-8
[»] chr4 (2 HSPs)
chr4 (7-85)||(21146915-21146994)
chr4 (40-85)||(21126821-21126866)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 3e-26; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 3e-26
Query Start/End: Original strand, 7 - 85
Target Start/End: Complemental strand, 21146994 - 21146915
Alignment:
7 attgacaga-aaattaaatccttgtcctattcaagttcccttgcatccagtttgccaacatctgaagtgcaacttttggt 85  Q
    ||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||    
21146994 attgacagataaattaaatacttgtcctattcaagttcccatgcatccagtttgccaacatctgaagtgcagcttttggt 21146915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 40 - 85
Target Start/End: Complemental strand, 21126866 - 21126821
Alignment:
40 gttcccttgcatccagtttgccaacatctgaagtgcaacttttggt 85  Q
    |||||| |||||||||||||||||||||||||||||| ||||||||    
21126866 gttcccatgcatccagtttgccaacatctgaagtgcagcttttggt 21126821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2220 times since January 2019
Visitors: 846