View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-8F-Insertion-13 (Length: 297)
Name: NF0440-8F-Insertion-13
Description: NF440-8F
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-8F-Insertion-13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 31 - 275
Target Start/End: Original strand, 52288836 - 52289081
Alignment:
| Q |
31 |
atagcatgcaattccgcattcattaaagtcgtttggtatagtacctgttggcttggctgcatttgatgatgattaaataataacagtagaactaatcaaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52288836 |
atagcatgcaattccgcattcattaaagtcgtttggtatagtacctgttggcttggctgcatttgatgatgattaaataataacagtagaactaatcaaa |
52288935 |
T |
|
| Q |
131 |
ttccaaggattacacaatttccactttttaccggattcctggttttgtttttgttttaacacac-tttagtatatcttgcacacggttaaggctaggccc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
52288936 |
ttccaaggattacacaatttccactttttaccggattcctggttttgtttttgttttaacacacttttagtataacttgcacacggttaaggttaggccc |
52289035 |
T |
|
| Q |
230 |
tgcttaaagtttttgtgtagacacatataaaacatgggattctttt |
275 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52289036 |
tgcttaagctttttgtgtagacacatacaaaacatgggattctttt |
52289081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University