View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-8F-Insertion-21 (Length: 210)
Name: NF0440-8F-Insertion-21
Description: NF440-8F
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-8F-Insertion-21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 8 - 198
Target Start/End: Complemental strand, 42981374 - 42981184
Alignment:
| Q |
8 |
gagagggcagctgcccccaattatttagcttttgatttgtgtttgcctcaaagacttcaacactcgagtaaagtaagagagcaaaatgaaagtgagatat |
107 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42981374 |
gagagggcagctgccccaaattacttagcttttgatttgtgtttaccttaaagacttcgacactcgagtaaagtaagagagcaaaatgagagtgagatat |
42981275 |
T |
 |
| Q |
108 |
atttgagaaagaagttttgtatctgtgtgagttgtgattgacatgtatataaacatcgatgttcgaggaggaataatagtggacggttaca |
198 |
Q |
| |
|
|||| |||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42981274 |
atttaagaaagaagttttgtacctttgcgagttgtgattgacatgtatataaacatcgatgttcgaggaggaataatagtggactgttaca |
42981184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University