View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-8F-Insertion-23 (Length: 157)
Name: NF0440-8F-Insertion-23
Description: NF440-8F
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-8F-Insertion-23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 5e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 5e-73
Query Start/End: Original strand, 15 - 157
Target Start/End: Original strand, 53267853 - 53267995
Alignment:
| Q |
15 |
cttccattgaacatattataaatttgatatgatgctcactagacacgtaaacatatttatttgatccaatcgttgagtttgttatttcagttctaattta |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267853 |
cttccattgaacacattataaatttgatatgatgctcactagacacgtaaacatatttatttgatccaatcgttgagtttgttatttcagttctaattta |
53267952 |
T |
 |
| Q |
115 |
atcgaagatttttctaaacacatttgttgctatactatctgat |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267953 |
atcgaagatttttctaaacacatttgttgctatactatctgat |
53267995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University