View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-Insertion-10 (Length: 270)
Name: NF0440-Insertion-10
Description: NF0440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-Insertion-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 270
Target Start/End: Original strand, 23561374 - 23561638
Alignment:
| Q |
8 |
tattaaaccagcacacagcatacaccttctaaatttggattacttgatctgcaatttttcaaaaattgctcacagcctttacttttgttaagatatcata |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23561374 |
tattaaaccagcacacaacatacaccttctaaatttggattacttgatctgcaatttttcttaaattgctcacagcctttacttttgttaagatatcata |
23561473 |
T |
|
| Q |
108 |
acaatggacagtaggcttcacgatacgttggaagagtagcagcctcagatgtatttagtttgataagttaaactttgatcctgattaaatttgactgtaa |
207 |
Q |
| |
|
| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
23561474 |
ataatgcacagtaggcttcacgatacgttggaaaagtagcagcctcagatgtatttagtttggtaagttacattttgatcctgattaaatttgactgtaa |
23561573 |
T |
|
| Q |
208 |
ga--acacacactatctcattcgcgaatttaattactttttatcctttgtaagtagccgaagtga |
270 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23561574 |
gaacacacacactatctcattcgcgaatttaattactttttatcctttgtaagtagccgaagtga |
23561638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University