View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-Insertion-13 (Length: 143)
Name: NF0440-Insertion-13
Description: NF0440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-Insertion-13 |
 | |
|
| [»] chr4 (4 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 8e-19; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 92 - 143
Target Start/End: Original strand, 5154493 - 5154544
Alignment:
| Q |
92 |
gacaaattgagtggtttgtttttctatttcatatggctcactgtattttccc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5154493 |
gacaaattgagtggtttgtttttctatttcacatggctcactgtattttccc |
5154544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 93 - 143
Target Start/End: Original strand, 5180451 - 5180501
Alignment:
| Q |
93 |
acaaattgagtggtttgtttttctatttcatatggctcactgtattttccc |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
5180451 |
acaaattgagtggtttgtttttctatttcacatggctaactgtattttccc |
5180501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 92 - 140
Target Start/End: Complemental strand, 4844592 - 4844544
Alignment:
| Q |
92 |
gacaaattgagtggtttgtttttctatttcatatggctcactgtatttt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
4844592 |
gacaaattgagtggtttgtttttctatttcacatggttcactgtatttt |
4844544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 92 - 140
Target Start/End: Original strand, 5170999 - 5171047
Alignment:
| Q |
92 |
gacaaattgagtggtttgtttttctatttcatatggctcactgtatttt |
140 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| ||| |||| |||| |
|
|
| T |
5170999 |
gacaaactgagtggtttgtttttctatttcacatgactcgctgtttttt |
5171047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University