View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-Insertion-8 (Length: 304)
Name: NF0440-Insertion-8
Description: NF0440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-Insertion-8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 15 - 304
Target Start/End: Original strand, 53267853 - 53268142
Alignment:
| Q |
15 |
cttccattgaacatattataaatttgatatgatgctcactagacacgtaaacatatttatttgatccaatcgttgagtttgttatttcagttctaattta |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267853 |
cttccattgaacacattataaatttgatatgatgctcactagacacgtaaacatatttatttgatccaatcgttgagtttgttatttcagttctaattta |
53267952 |
T |
 |
| Q |
115 |
atcgaagatttttctaaacacatttgttgttatactatctgatcctttggttcactgcatttgtggcctccaagaatattgatcaccaggcttcactaag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53267953 |
atcgaagatttttctaaacacatttgttgctatactatctgatcctttggttcactgcatttgtggcctccaagaatattgatcactaggcttcactaag |
53268052 |
T |
 |
| Q |
215 |
cttcggagttcattgtttaaaccttgtggatatggctttgttggtaagaaaattttcttggtaaaaaactaaacgtagataagacttgca |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53268053 |
cttcggagttcattgtttaaaccttgtggatatggctttgttggtaagaaaattttcttggtaaaacactaaacgtagataagacttgca |
53268142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University