View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440-Insertion-9 (Length: 163)
Name: NF0440-Insertion-9
Description: NF0440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440-Insertion-9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 2e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 33050162 - 33050264
Alignment:
| Q |
8 |
ttagctagttagttagtgtatgattggcagctatgttaaggactccaatgaatt-ggtgattgatattgataccaatcaatcactaacttactaacttct |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33050162 |
ttagttagttagttagtgtatgattggcagctatgttaaggactccaatgaattgggtgattgatattgataccaatcaatcactaacttactaacttct |
33050261 |
T |
 |
| Q |
107 |
tgg |
109 |
Q |
| |
|
||| |
|
|
| T |
33050262 |
tgg |
33050264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University