View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_high_16 (Length: 302)
Name: NF0440_1D_high_16
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 20 - 173
Target Start/End: Complemental strand, 52288821 - 52288666
Alignment:
| Q |
20 |
attcacaaaccaaatttgcttgcatgggaatttgtaaataagacatatgtaagattccaaaatggctcttaaatttatagacaaacttttaacaaaatgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52288821 |
attcacaaaccaaatttgcttgcatgggaatttgtaaataagacatatataagattccaaaatggctcttaaatttatagacaaacttttaacaaaatgc |
52288722 |
T |
 |
| Q |
120 |
accataagtcgtgggtc--tattatgctcgacaaatactctatttactgcccacag |
173 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52288721 |
accataagtcgtgggtcaatattatgctcgacaaatactctatttactgcccacag |
52288666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 183 - 280
Target Start/End: Original strand, 37808661 - 37808758
Alignment:
| Q |
183 |
gttcactgttctcatgagaattttgtatcttgagaataataacaaattataaataatgaaaacaacgagatgcttacatgtccgttaaagacaatgtc |
280 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37808661 |
gttcaatgttctcatgagaattttgtatcttgagaataataacaaattataaataatgaaaacaacgagatgcttacatgtccgttaaagacaatgtc |
37808758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 227
Target Start/End: Original strand, 37816087 - 37816131
Alignment:
| Q |
183 |
gttcactgttctcatgagaattttgtatcttgagaataataacaa |
227 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
37816087 |
gttcaatgttctcatgagaattttggatcttgagaatgataacaa |
37816131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University