View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_high_19 (Length: 264)
Name: NF0440_1D_high_19
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 24 - 247
Target Start/End: Original strand, 153890 - 154113
Alignment:
| Q |
24 |
gtattttcactgctgcagcaattacagattggcttgatggctatattgctcgcaaggtaacctatcattgccttcacgtttgtttagtaattgattctac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153890 |
gtattttcactgctgcagcaattacagattggcttgatggctatattgctcgcaaggtaacctatcattgccttcacgtttgtttagtaattgattctac |
153989 |
T |
 |
| Q |
124 |
actttcttcctccttaaatacttacttgcattctattgcattgcagatgaaactaaaatcttcatttggtgcttttttggatccagtagcggacaaggtc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
153990 |
actttcttcctccttaaatacttacttgcattctattgcattgcagatgaaactaaaatcttcatttggtgcctttttggatccagtagcggacaaggtc |
154089 |
T |
 |
| Q |
224 |
agtcattctcctcccttaattacc |
247 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
154090 |
agtcattctcctcccttaattacc |
154113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 45 - 82
Target Start/End: Complemental strand, 52562547 - 52562510
Alignment:
| Q |
45 |
ttacagattggcttgatggctatattgctcgcaaggta |
82 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52562547 |
ttactgattggcttgatggctatattgctcgcaaggta |
52562510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University