View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_high_26 (Length: 220)
Name: NF0440_1D_high_26
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 41 - 195
Target Start/End: Complemental strand, 3384088 - 3383934
Alignment:
| Q |
41 |
tggtgttggtgattgtatgttgataaggaaggattatggttcaaagtattggttgttaaatatcgggtaagggtgggtgtgtaagaagtagagggagtaa |
140 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3384088 |
tggtattggtgattgtatgttgataaggaaggattatggttcaaagtattggttgttaaatatcgggtaagggtgggtgtgtaagaagtagagggagtaa |
3383989 |
T |
 |
| Q |
141 |
ggtgtctctttggtggaaggacttatgaggtgttagtcaagatgttgacactagc |
195 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3383988 |
ggtgtctgtttggtggaaggacttatgaggtgttagtcaagacgttgacactagc |
3383934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University