View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_high_28 (Length: 209)
Name: NF0440_1D_high_28
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_high_28 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 88 - 209
Target Start/End: Original strand, 24561374 - 24561492
Alignment:
| Q |
88 |
ttggtgttgagtgaattgttgagaattcaagctttcatggttgttttgtaatgttagcaatggttgaggttgttgttcaaattggtgatgatattgcatg |
187 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24561374 |
ttggtgttgagagaattgttgagaattcaagctttcatggttgttttgtaatgttagcaatggttgag---gttgttcaaattggtgatgatattgcatg |
24561470 |
T |
|
| Q |
188 |
agaggatagggttggagtctag |
209 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
24561471 |
agagggtagggttggagtctag |
24561492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 21 - 90
Target Start/End: Original strand, 42439089 - 42439158
Alignment:
| Q |
21 |
catgtaagatgttgattttgtattttttaaattctttattatatgttttgatgcatttcaatcgagtttg |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42439089 |
catgtaagatgttgattttgtattttttaaattctttattatatgttttgatgcatttcaatcgagtttg |
42439158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University