View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_low_12 (Length: 359)
Name: NF0440_1D_low_12
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 286; Significance: 1e-160; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 23332900 - 23332595
Alignment:
| Q |
1 |
atgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggtctatctgcgggatggttgggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23332900 |
atgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcaaggtcaaggtccacgtgaaaaatggcaaggtttatctgcgggatggttgggc |
23332801 |
T |
 |
| Q |
101 |
tgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagagatcagga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332800 |
tgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagagatcagga |
23332701 |
T |
 |
| Q |
201 |
gtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcgtcc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332700 |
gtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtcc |
23332601 |
T |
 |
| Q |
301 |
acatat |
306 |
Q |
| |
|
| |||| |
|
|
| T |
23332600 |
atatat |
23332595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 301 - 343
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
| Q |
301 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
343 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 301 - 343
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
| Q |
301 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
343 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 79
Target Start/End: Original strand, 10955092 - 10955166
Alignment:
| Q |
3 |
gttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
79 |
Q |
| |
|
|||||||| |||||||| |||||||||| |||| |||||||||||||| ||||||||| ||| || |||||||| |
|
|
| T |
10955092 |
gttgatgactatgtcat--tgcgtgatcctaacaagaacatgttcgaggttaaggtccacaagaagaagggcaaggt |
10955166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 12 - 79
Target Start/End: Complemental strand, 2027759 - 2027692
Alignment:
| Q |
12 |
tatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
79 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| ||||| || || ||| ||||||||||||||| |
|
|
| T |
2027759 |
tatgtcattttgcgtgatccaaacaagaacatgtttgaggttaaagttcacaagaaaaatggcaaggt |
2027692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University