View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440_1D_low_27 (Length: 258)

Name: NF0440_1D_low_27
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440_1D_low_27
NF0440_1D_low_27
[»] chr3 (4 HSPs)
chr3 (1-116)||(8431974-8432089)
chr3 (205-249)||(8431318-8431362)
chr3 (1-57)||(8437594-8437650)
chr3 (1-57)||(8440819-8440875)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 8432089 - 8431974
Alignment:
1 taaataaggaaaaatgctcgaatgtaaattaaattaagcttgcctagctaaatattacatgacttgatctatgttgcattaacttgtaaacacagctact 100  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||    
8432089 taaataaggaaaaatactcgaatgtaaattaaattaagcttgcctagctaaatattacatgaattgatatatgttgcattaacttgtaaacacagctact 8431990  T
101 ttctaacatggaaatt 116  Q
    ||||||||||||||||    
8431989 ttctaacatggaaatt 8431974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 8431362 - 8431318
Alignment:
205 aagttgcatgcatatttaccttaatcgatgtatgatgtccatctc 249  Q
    ||||||||||||||||||||||||||||||||||||||| |||||    
8431362 aagttgcatgcatatttaccttaatcgatgtatgatgtcaatctc 8431318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 8437650 - 8437594
Alignment:
1 taaataaggaaaaatgctcgaatgtaaattaaattaagcttgcctagctaaatatta 57  Q
    |||| |||||||||| || |||||| ||||||| |||||||||||||| ||||||||    
8437650 taaacaaggaaaaatacttgaatgttaattaaactaagcttgcctagccaaatatta 8437594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 8440875 - 8440819
Alignment:
1 taaataaggaaaaatgctcgaatgtaaattaaattaagcttgcctagctaaatatta 57  Q
    |||| |||||||||| || |||||| ||||||| |||||||||||||| ||||||||    
8440875 taaacaaggaaaaatacttgaatgttaattaaactaagcttgcctagccaaatatta 8440819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University