View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_low_27 (Length: 258)
Name: NF0440_1D_low_27
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 8432089 - 8431974
Alignment:
| Q |
1 |
taaataaggaaaaatgctcgaatgtaaattaaattaagcttgcctagctaaatattacatgacttgatctatgttgcattaacttgtaaacacagctact |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8432089 |
taaataaggaaaaatactcgaatgtaaattaaattaagcttgcctagctaaatattacatgaattgatatatgttgcattaacttgtaaacacagctact |
8431990 |
T |
|
| Q |
101 |
ttctaacatggaaatt |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8431989 |
ttctaacatggaaatt |
8431974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 8431362 - 8431318
Alignment:
| Q |
205 |
aagttgcatgcatatttaccttaatcgatgtatgatgtccatctc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8431362 |
aagttgcatgcatatttaccttaatcgatgtatgatgtcaatctc |
8431318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 8437650 - 8437594
Alignment:
| Q |
1 |
taaataaggaaaaatgctcgaatgtaaattaaattaagcttgcctagctaaatatta |
57 |
Q |
| |
|
|||| |||||||||| || |||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
8437650 |
taaacaaggaaaaatacttgaatgttaattaaactaagcttgcctagccaaatatta |
8437594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 8440875 - 8440819
Alignment:
| Q |
1 |
taaataaggaaaaatgctcgaatgtaaattaaattaagcttgcctagctaaatatta |
57 |
Q |
| |
|
|||| |||||||||| || |||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
8440875 |
taaacaaggaaaaatacttgaatgttaattaaactaagcttgcctagccaaatatta |
8440819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University