View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_low_29 (Length: 249)
Name: NF0440_1D_low_29
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 42507889 - 42507669
Alignment:
| Q |
17 |
agtagcacagtctggatttctttatctttatctgcttaaatagtacgattgtttattcgtgtaccaacaatgattaaataatcttatgttcattaaaaga |
116 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42507889 |
agtagcacagtctggatctctttatctttatctgcttaaatagtatgattgtttattcgtgtaccaacaatgattaaataatcttatgttcattaaaaga |
42507790 |
T |
 |
| Q |
117 |
taatgaattgtagatatcaaaaaccttgatttccttttcatttttaccaaaggaaagtcactgcatttcactaaggagtaagcatgacaagaaagtatgg |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42507789 |
aaatgaattgtaaatatcaaaaaccttgatttccttttcatttttaccaaaggaaagtcactgcatttcactaaagagtaagcatgacaagaaagtatgg |
42507690 |
T |
 |
| Q |
217 |
actgatcatacatatagagaa |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42507689 |
actgatcatacatatagagaa |
42507669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University