View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_low_32 (Length: 241)
Name: NF0440_1D_low_32
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 50 - 235
Target Start/End: Complemental strand, 23697513 - 23697328
Alignment:
| Q |
50 |
tcctactcaatattacatatcacaatcatattttcaaatatacatcaatcaagcaattgatgtaacgttgtgctatgcaatttcactcgtcatgccattt |
149 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23697513 |
tcctactcaatattacatatcaaaatcatattttcaaatatatatcaatcaagcaattgatgtaacgttgtgctatgcaatttcactcgtcatgcaattt |
23697414 |
T |
|
| Q |
150 |
ctatccagttgcacacttataatgggagtcagtattccaagtggatccacatccatagcaaaattgattaccacacctgcggataa |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23697413 |
ctatccagttgcacacttataatgggagtcagtattccaagtggatccacatccatagcaaaattgattaccacacctgcggataa |
23697328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 229
Target Start/End: Original strand, 23700587 - 23700648
Alignment:
| Q |
168 |
ataatgggagtcagtattccaagtggatccacatccatagcaaaattgattaccacacctgc |
229 |
Q |
| |
|
||||||||| | | ||||||||| || ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
23700587 |
ataatgggactgattattccaaggagaaccacagccatagcaaaattgattgccacacctgc |
23700648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University